LOC568677

Ensembl ID:
ENSDARG00000062165
Human Orthologue:
TUB
Human Description:
tubby homolog (mouse) [Source:HGNC Symbol;Acc:12406]
Mouse Orthologue:
Tub
Mouse Description:
tubby candidate gene Gene [Source:MGI Symbol;Acc:MGI:2651573]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18104 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089574 Nonsense 74 503 3 12
Genomic Location:
Chromosome 7 (position 29132017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGCAGGACCCGGCAGTCAGAGGAACAGGCTCCCCTYGTGGAGAGCTA[C/A]CTCAGCGGAAACAGCAGCACCATCTACCACGGTAYAAACTACAGTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m3hs4m05