si:ch211-88n13.1

Ensembl ID:
ENSDARG00000062156
ZFIN ID:
ZDB-GENE-070912-325
Description:
Novel protein similar to vertebrate ABI gene family, member 3 (NESH) binding protein (ABI3BP) [Sourc
Human Orthologue:
ABI3BP
Human Description:
ABI family, member 3 (NESH) binding protein [Source:HGNC Symbol;Acc:17265]
Mouse Orthologue:
Abi3bp
Mouse Description:
ABI gene family, member 3 (NESH) binding protein Gene [Source:MGI Symbol;Acc:MGI:2444583]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41446 Nonsense Mutation detected in F1 DNA During 2017
sa41445 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12479 Essential Splice Site Available for shipment Available now
sa31723 Nonsense Available for shipment Available now
sa21504 Nonsense Available for shipment Available now
sa8500 Nonsense Mutation detected in F1 DNA During 2017
sa18355 Essential Splice Site Available for shipment Available now
sa9166 Nonsense Mutation detected in F1 DNA During 2017
sa7190 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 41 1072 1 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986 Nonsense 45 128 1 3
Genomic Location (Zv9):
Chromosome 9 (position 31194074)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30350020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGACTGGGAGGGTATATCCTGGGCTATGGCAGCAGCATGTTCTCCAAA[C/T]AATTCATCCAGCTGCCGGAGGATGGACAACCTTATGAGACTGAGATAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 56 1072 1 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986 Essential Splice Site 60 128 1 3
Genomic Location (Zv9):
Chromosome 9 (position 31194025)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30349971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTCATCCAGCTGCCGGAGGATGGACAACCTTATGAGACTGAGATAG[G/A]TAATGTCGTTCTTCTACTCTTTAAATAACTTTAGTGCTTTTTAAAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 57 1072 None 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986 Essential Splice Site 61 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31194024)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30349970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATTCATCCARCTGCCGGAGGATGGACAACCWTATGAGACTGAGATAGG[T/A]AMTGTCGTTCTTCTACTCTTTAAAWAAYTTTAGTGCTTTTTAAAACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 144 1072 4 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31191064)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30347010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGCTACAGAGAACAAGAGCCCAGCAATACCTGGAACTATCAAACCTG[T/A]CCATCCTCCAGCACAGTCATCGACAACCTCAAACCAGATGTGTTGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 471 1072 9 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31187925)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30343871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAGCAGACAACCAGTATTTAGCACTACTGCATCCACCTATACCAAATA[T/A]TCTATATTCCATATTCCCACAACTGAAGATCCTCCTCTTAACAAAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 674 1072 13 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31181877)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30337823
KASP Assay ID:
2260-1962.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTCATGGTGAGGGTCACATAGGCCTTCATGGAWACAAGCCTAGAAAA[C/T]AACCTGGTAAACTCTTTTATGGATTATYTTTGAAGRTTATTTAGTNNNNNNNNNNAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Essential Splice Site 676 1072 14 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31181644)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30337590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCTTACAGGTTTAATGTGGTGTTTCAGATAGATGTCCCTGTTTTGT[T/A]GAAAACAWCTCCTGTGCAGAAAACGATTCCCAWGCAGCTGGATTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31179881)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30335827
KASP Assay ID:
554-5132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAWAGGAAATAGTKAATAGYGAGAATTGATCCCTGCCAGATGTTACCAAC[C/T]AAGTGTTACCAAATAATGTWAAAAAAATCCTWTTAATTTTGTCATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
ENSDART00000089543 Nonsense 751 1072 17 26
ENSDART00000133746   None 290 None 8
ENSDART00000143986   None 128 None 3
Genomic Location (Zv9):
Chromosome 9 (position 31179881)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30335827
KASP Assay ID:
554-5132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAWAGGAAATAGTKAATAGTGAGAATTGATCCCTGCCAGATGTTACCAAC[C/T]AAGTGTTACCAAATAATGTAAAAAAAATCCTWTTAATTTTGTCATTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link