si:dkey-181h23.2

Ensembl ID:
ENSDARG00000062154
ZFIN ID:
ZDB-GENE-091113-28
Human Orthologue:
DIP2C
Human Description:
DIP2 disco-interacting protein 2 homolog C (Drosophila) [Source:HGNC Symbol;Acc:29150]
Mouse Orthologue:
Dip2c
Mouse Description:
DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24518 Essential Splice Site Available for shipment Available now
sa37910 Nonsense Mutation detected in F1 DNA During 2017
sa7521 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089541 Essential Splice Site 212 1243 5 30
ENSDART00000137212   None 1620 None 37

The following transcripts of ENSDARG00000062154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28004298)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27054885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGACGCCTGGCTGACGTTCTGGCTCAAACGCACATGGGCAAATCAGG[T/C]AACGCCTTCTTCAGCAAGCCCCACCTCTCCATGCATACCACAGCCAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089541 Nonsense 478 1243 12 30
ENSDART00000137212 Nonsense 506 1620 11 37

The following transcripts of ENSDARG00000062154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28030401)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27080988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTATTTCTCTGTGTGTGTGTGTGTGTACATTAGGATGCAGGAAGTCAA[C/T]AGATCGGCTTTCTCCTGGGCAGTTGTGGGGTTACAGTGGCTCTGACCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089541   None 1243 None 30
ENSDART00000137212 Missense 1440 1620 35 37

The following transcripts of ENSDARG00000062154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28089586)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27140173
KASP Assay ID:
554-4047.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGATGACAGTTTTGTTTACAGYATCACGTGTCTCTCACTAGATCTGGG[T/G]TCACTGCGCTCATAACGGCAGCGGTTATTTCACGGTGTATGGAGACGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link