chaf1a

Ensembl ID:
ENSDARG00000062152
ZFIN ID:
ZDB-GENE-030131-5366
Description:
Chromatin assembly factor 1 subunit A [Source:UniProtKB/Swiss-Prot;Acc:A0JMK9]
Human Orthologue:
CHAF1A
Human Description:
chromatin assembly factor 1, subunit A (p150) [Source:HGNC Symbol;Acc:1910]
Mouse Orthologue:
Chaf1a
Mouse Description:
chromatin assembly factor 1, subunit A (p150) Gene [Source:MGI Symbol;Acc:MGI:1351331]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18462 Nonsense Available for shipment Available now
sa3192 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089534 Nonsense 493 838 10 16
ENSDART00000111711 Nonsense 518 863 10 16
ENSDART00000142027 Nonsense 453 798 11 17
Genomic Location:
Chromosome 22 (position 22651129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCKTTATCAGGATCTGCTGGATTATGAGGTGGACAGTGATGAAGART[G/A]GGAGGAGGAGGAGCCAGGAGAGTCTCTGTCACACAGTGAGGGGGTGAGCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3192
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089534 Nonsense 649 838 13 16
ENSDART00000111711 Nonsense 674 863 13 16
ENSDART00000142027 Nonsense 609 798 14 17
Genomic Location:
Chromosome 22 (position 22650148)
KASP Assay ID:
554-3341.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAATGTGAATAGCAATAAGGTGATAATCACMGAGTTCCTCGAGTTTTG[T/A]CGCCAACAAACCTCCTCGCCCACAGAAAGCCTTCTCAATACGACAGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ka80p9d4