si:dkey-100n23.3

Ensembl ID:
ENSDARG00000062148
ZFIN ID:
ZDB-GENE-070912-345
Description:
LOC571373 protein [Source:UniProtKB/TrEMBL;Acc:A8WFW9]
Human Orthologue:
SENP7
Human Description:
SUMO1/sentrin specific peptidase 7 [Source:HGNC Symbol;Acc:30402]
Mouse Orthologue:
Senp7
Mouse Description:
SUMO1/sentrin specific peptidase 7 Gene [Source:MGI Symbol;Acc:MGI:1913565]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17833 Nonsense Available for shipment Available now
sa7191 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089539 Nonsense 488 991 10 21
ENSDART00000128876 Nonsense 488 991 9 20
ENSDART00000131519   None 217 None 5
ENSDART00000140929   None 141 None 4
Genomic Location (Zv9):
Chromosome 9 (position 31262833)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30418779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTTCAGATTCTASAGTGAAAATTTCTTTGTCAGMGATTAATGTGTA[T/G]AAATATAGCTTGTGGGAGGAGCATACATTATGGGGGTGTGATCTGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089539 Nonsense 888 991 20 21
ENSDART00000128876 Nonsense 888 991 19 20
ENSDART00000131519   None 217 None 5
ENSDART00000140929 Nonsense 58 141 4 4
Genomic Location (Zv9):
Chromosome 9 (position 31251689)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30407635
KASP Assay ID:
554-5270.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTATGGTCATTATATTTTATTCTTTTTCAGGTACCTTCAGGTTGAAT[G/A]GGAGACAAAGAGAATGGGTACTCGTGACTTTAGTGCTGAACGTATGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link