otc

Ensembl ID:
ENSDARG00000062147
ZFIN ID:
ZDB-GENE-070912-422
Human Orthologue:
OTC
Human Description:
ornithine carbamoyltransferase [Source:HGNC Symbol;Acc:8512]
Mouse Orthologue:
Otc
Mouse Description:
ornithine transcarbamylase Gene [Source:MGI Symbol;Acc:MGI:97448]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34672 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089526 Nonsense 236 352 7 10

The following transcripts of ENSDARG00000062147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31303265)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30459211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTTATGAGCCAGATGCTGCTGTCACTGAAGAGGCTCAGCGTCTGGCA[A/T]AGCAGGTACTGTAAACACAGAAGGCATCAATACAGTTCATATACTAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link