si:ch211-218n12.1

Ensembl ID:
ENSDARG00000062144
ZFIN ID:
ZDB-GENE-081104-177
Description:
Novel protein similar to H.sapiens SHANK3, SH3 and multiple ankyrin repeat domains 3 (SHANK3) [Sourc
Human Orthologue:
SHANK3
Human Description:
SH3 and multiple ankyrin repeat domains 3 [Source:HGNC Symbol;Acc:14294]
Mouse Orthologue:
Shank3
Mouse Description:
SH3/ankyrin domain gene 3 Gene [Source:MGI Symbol;Acc:MGI:1930016]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091805 Nonsense 146 381 2 7
ENSDART00000145002 Nonsense 146 199 2 3
Genomic Location (Zv9):
Chromosome 18 (position 7488995)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8001105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAGAGCCTGAAGGAWGTGCTGAACTAYGGACTCTTTCTGCCTGCGTA[C/A]AACGGCAAAGCTGGCAAATTCCTAGACGAGCAGCGCACACTGAAAGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link