eif2ak3

Ensembl ID:
ENSDARG00000062139
ZFIN ID:
ZDB-GENE-050414-2
Description:
eukaryotic translation initiation factor 2-alpha kinase 3 [Source:RefSeq peptide;Acc:NP_001070617]
Human Orthologue:
EIF2AK3
Human Description:
eukaryotic translation initiation factor 2-alpha kinase 3 [Source:HGNC Symbol;Acc:3255]
Mouse Orthologue:
Eif2ak3
Mouse Description:
eukaryotic translation initiation factor 2 alpha kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1341830]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4496 Essential Splice Site F2 line generated During 2014
sa451 Essential Splice Site Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa4496
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997 None None 1099 None 17
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997 None None 1099 None 17

The following transcripts of ENSDARG00000062139 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 13865154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCACTCTGTAACCCACGTCAGGGACCACTTTGTGAGTCTTCACCT[C/T]GTAAGCTGTATCTGTGAAGYGTCCCGGTGAAGATCCTTTTTGTTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa451
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997 None None 1099 None 17
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997 None None 1099 None 17

The following transcripts of ENSDARG00000062139 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 13865154)
KASP Assay ID:
554-0378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCACTCTGTAACCCACGTCAGGGACCACTTTGTGAGTCTTCACCT[C/T]GTAAGCTGTATCTGTGAAGTGTCCCGGTGAAGATCCTTTTTGTTCAAGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fpv3xwjh