eif2ak3

Ensembl ID:
ENSDARG00000062139
ZFIN ID:
ZDB-GENE-050414-2
Description:
eukaryotic translation initiation factor 2-alpha kinase 3 [Source:RefSeq peptide;Acc:NP_001070617]
Human Orthologue:
EIF2AK3
Human Description:
eukaryotic translation initiation factor 2-alpha kinase 3 [Source:HGNC Symbol;Acc:3255]
Mouse Orthologue:
Eif2ak3
Mouse Description:
eukaryotic translation initiation factor 2 alpha kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1341830]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42159 Nonsense Mutation detected in F1 DNA During 2016
sa4496 Essential Splice Site F2 line generated During 2016
sa451 Essential Splice Site Confirmed mutation in F2 line During 2016

Mutation Details

Allele Name:
sa42159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089501 Nonsense 249 323 5 7
ENSDART00000142997 Nonsense 302 1099 5 17

The following transcripts of ENSDARG00000062139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 13843818)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13851813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGTCAGACGTGAAGCACAGCGTGTTATCCAGGAGGAGACGGACGCA[C/T]AAACCAAAAATCATGCTAAGATGCACCCAAACTCAGCGCATACTCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4496
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997   None 1099 None 17
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997   None 1099 None 17

The following transcripts of ENSDARG00000062139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 13865154)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13873149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCACTCTGTAACCCACGTCAGGGACCACTTTGTGAGTCTTCACCT[C/T]GTAAGCTGTATCTGTGAAGYGTCCCGGTGAAGATCCTTTTTGTTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa451
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997   None 1099 None 17
ENSDART00000089501 Essential Splice Site 323 323 7 7
ENSDART00000142997   None 1099 None 17

The following transcripts of ENSDARG00000062139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 13865154)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 13873149
KASP Assay ID:
554-0378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCACTCTGTAACCCACGTCAGGGACCACTTTGTGAGTCTTCACCT[C/T]GTAAGCTGTATCTGTGAAGTGTCCCGGTGAAGATCCTTTTTGTTCAAGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link