si:ch211-197k23.5

Ensembl ID:
ENSDARG00000062137
ZFIN ID:
ZDB-GENE-030131-1393
Human Orthologue:
STAG1
Human Description:
stromal antigen 1 [Source:HGNC Symbol;Acc:11354]
Mouse Orthologue:
Stag1
Mouse Description:
stromal antigen 1 Gene [Source:MGI Symbol;Acc:MGI:1098658]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37909 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24517 Nonsense Available for shipment Available now
sa14968 Nonsense Available for shipment Available now
sa24516 Nonsense Available for shipment Available now
sa37908 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 96 1256 4 33
ENSDART00000142864 Essential Splice Site 96 1256 5 34
Genomic Location (Zv9):
Chromosome 24 (position 27850670)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26901257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGTTGTGTGCTGCTTTGTGACTGTTGTTTCGCTTTGCAAATGTTTCC[A/T]GTCGGTCATTGATGATTGGATTGAATCCTACAAGCAAGATCGAGACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 139 1256 5 33
ENSDART00000142864 Nonsense 139 1256 6 34
Genomic Location (Zv9):
Chromosome 24 (position 27848257)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26898844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTTATTATCACAGGCACTGTACGGATCGAGATGTTCAGGAACATG[C/T]AGAATGCTGAAATAATCAGGAAAATGACAGAAGAGTTTGATGAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 327 1256 9 33
ENSDART00000142864 Nonsense 327 1256 10 34
Genomic Location (Zv9):
Chromosome 24 (position 27842867)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26893454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGTGTTTGGATGAAGTTGTACAGTGATGCTTTTCTTAATGACAGTTA[T/A]CTAAAGTACGTGGGTTGGACACTACATGACAGAGYAAGTGTTNNATTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Nonsense 752 1256 21 33
ENSDART00000142864 Nonsense 752 1256 22 34
Genomic Location (Zv9):
Chromosome 24 (position 27835319)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26885906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTCATTACTCCATCCTGTGGCAGCTGGTGAAAATCACTGAAGGATG[T/A]CCATCAAAGGTACGGTACACACCAATAAATGCAGATGACAAAAATAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089376 Essential Splice Site 1222 1256 31 33
ENSDART00000142864 Essential Splice Site 1222 1256 32 34
Genomic Location (Zv9):
Chromosome 24 (position 27822592)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 26873179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGAGGACATGAACGAGGAGTTTGAGGATACTATGGTCATAGATCTGG[T/A]AAGAGTTCACATATGTGACGAGTCCTTCAGTGTATTTTTGATGTTTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link