cyp4v2

Ensembl ID:
ENSDARG00000062132
ZFIN ID:
ZDB-GENE-061103-601
Description:
cytochrome P450, family 4, subfamily V, polypeptide 2 [Source:RefSeq peptide;Acc:NP_001071070]
Human Orthologue:
CYP4V2
Human Description:
cytochrome P450, family 4, subfamily V, polypeptide 2 [Source:HGNC Symbol;Acc:23198]
Mouse Orthologue:
Cyp4v3
Mouse Description:
cytochrome P450, family 4, subfamily v, polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:2142763]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4839 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089480 Nonsense 135 513 4 11

The following transcripts of ENSDARG00000062132 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 16644714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAATACATTCATTTTTATTTTTCCTTTGGTTAGTACTGGGGATAAGT[G/A]GAGACGCAGACGCAAGATGCTGACTCCAACATTTCATTTCTCSATACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vrwthsqp