mxra8b

Ensembl ID:
ENSDARG00000062129
ZFIN ID:
ZDB-GENE-061013-368
Description:
matrix-remodelling associated 8b [Source:RefSeq peptide;Acc:NP_001073429]
Human Orthologue:
MXRA8
Human Description:
matrix-remodelling associated 8 [Source:HGNC Symbol;Acc:7542]
Mouse Orthologue:
Mxra8
Mouse Description:
matrix-remodelling associated 8 Gene [Source:MGI Symbol;Acc:MGI:1922011]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089465 Nonsense 193 434 5 10
Genomic Location:
Chromosome 23 (position 30133399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYTGTGTGATCCGCAGGCAGTTKTGGACGGATAGTCAGAGGGATGAGGRC[C/T]AGCAGCAGGTGGTCCACTGGGACTGGCAGGCACCTGGAGTKACCCGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dk6iapf1