agap1

Ensembl ID:
ENSDARG00000062123
Human Orthologues:
AGAP1, AGAP10, AGAP4, AGAP5, AGAP6, AGAP7, AGAP8, AGAP9
Human Descriptions:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:16922]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 10 [Source:HGNC Symbol;Acc:23462]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 4 [Source:HGNC Symbol;Acc:23459]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 5 [Source:HGNC Symbol;Acc:23467]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 6 [Source:HGNC Symbol;Acc:23466]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 7 [Source:HGNC Symbol;Acc:23465]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 8 [Source:HGNC Symbol;Acc:23464]
ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 [Source:HGNC Symbol;Acc:23463]
Mouse Orthologue:
Agap1
Mouse Description:
ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 Gene [Source:MGI Symbol;Acc:MGI:2653690]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14894 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089445 Nonsense 29 858 1 18
Genomic Location:
Chromosome 6 (position 16311207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGGGGGGAGATACAGAGGTTCGAGTCCGTCCATCCCAACATCTATTG[C/A]ATCTACGAGCTGCTGGAGCGGGTGGAGGATCCTCTGCTGCAGAATCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yo03zag2