klhl5

Ensembl ID:
ENSDARG00000062122
ZFIN ID:
ZDB-GENE-080424-7
Description:
kelch-like protein 5 [Source:RefSeq peptide;Acc:NP_001164413]
Human Orthologue:
KLHL5
Human Description:
kelch-like 5 (Drosophila) [Source:HGNC Symbol;Acc:6356]
Mouse Orthologue:
Klhl5
Mouse Description:
kelch-like 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1919028]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4840 Nonsense Mutation detected in F1 DNA During 2014
sa11657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089442 Nonsense 241 769 2 11
Genomic Location:
Chromosome 1 (position 17163097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCCTACCTGAGGACCAGGAAACTTTGTGACGTTGTGCTTCTCGCT[G/T]GAGATCGCAGAATACCRGCACACAGGTAATAAATAGTATACTTATTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089442 Nonsense 384 769 5 11
Genomic Location:
Chromosome 1 (position 17141345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCATCAGGAGTTWCTGCTCTTRCCCTCATGTGAAGTGGAGAAGCTTT[T/A]AGCGTCTGATGACATGAACGTTCCAGAGGAGGAAACCGTGGTAACAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2oz7pov7