ctdsplb

Ensembl ID:
ENSDARG00000062116
ZFIN ID:
ZDB-GENE-060929-488
Description:
CTD small phosphatase-like protein [Source:RefSeq peptide;Acc:NP_001070083]
Human Orthologue:
CTDSPL
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like [Source:HGNC
Mouse Orthologue:
Ctdspl
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like Gene [Source:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31274 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089433 Nonsense 48 266 2 7
ENSDART00000145670 Nonsense 48 113 2 3
ENSDART00000146600 Nonsense 48 124 2 4

The following transcripts of ENSDARG00000062116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 21163988)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21709926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGAAGAAGAAAAGGACTCGTAGCATCTTCAGCTCGCTGTTCTGTTG[T/A]CTGAGGAGTTACGATGCTGACACTCCTGCGACCCCCAACAACAACAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link