papd7

Ensembl ID:
ENSDARG00000062114
ZFIN ID:
ZDB-GENE-041021-1
Description:
Novel protein similar to vertebrate polymerase (DNA directed) sigma (POLS) [Source:UniProtKB/TrEMBL;
Human Orthologue:
PAPD7
Human Description:
PAP associated domain containing 7 [Source:HGNC Symbol;Acc:16705]
Mouse Orthologue:
Papd7
Mouse Description:
PAP associated domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2682295]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23540 Essential Splice Site Available for shipment Available now
sa23539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089425 Essential Splice Site 714 762 12 14
ENSDART00000131767 Essential Splice Site 535 583 12 13
Genomic Location (Zv9):
Chromosome 19 (position 28296717)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28226829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCCCAGCTCCCCCCAGCCCTCTACCCAGTCCCCTTCACCATCCCAAG[G/A]TAGGCTGTCCTGTGTCTGCTCTCCTCTTCATGCTGTGAGTGTCATGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089425 Nonsense 743 762 13 14
ENSDART00000131767 Nonsense 564 583 13 13
Genomic Location (Zv9):
Chromosome 19 (position 28293140)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28223252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGCCGTGGTGCACAGTCCTGTCCTTTCCAACCGAGGCCACATTCAGTA[C/A]AACCGCAACACGTGGCGCCGCAGGAAGAGGGACAGTTTGCCGGCCAGCGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link