shdb

Ensembl ID:
ENSDARG00000062109
ZFIN ID:
ZDB-GENE-030131-6059
Description:
SH2 domain-containing adapter protein D [Source:RefSeq peptide;Acc:NP_001038542]
Human Orthologue:
SHD
Human Description:
Src homology 2 domain containing transforming protein D [Source:HGNC Symbol;Acc:30633]
Mouse Orthologue:
Shd
Mouse Description:
src homology 2 domain-containing transforming protein D Gene [Source:MGI Symbol;Acc:MGI:1099461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16983 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089408 Nonsense 4 391 2 7
Genomic Location (Zv9):
Chromosome 22 (position 21721373)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21374621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACACGTAGAGTCTTTGTGCCTTTCCAAAGAGATCAGAATGGCRAAGTG[G/A]TTAAAGGACTATTTAAGTTTTGGGAGCAAAYGAGTTCCCCCGCAACCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link