im:7147934

Ensembl ID:
ENSDARG00000062108
ZFIN ID:
ZDB-GENE-050208-308
Human Orthologue:
IFFO1
Human Description:
intermediate filament family orphan 1 [Source:HGNC Symbol;Acc:24970]
Mouse Orthologue:
Iffo1
Mouse Description:
intermediate filament family orphan 1 Gene [Source:MGI Symbol;Acc:MGI:2444516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28625 Nonsense Mutation detected in F1 DNA During 2017
sa36088 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386 Nonsense 364 640 3 9
ENSDART00000123011 Nonsense 364 614 3 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19206913)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17237236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATGTGTTTTTGTCTATATGTGTAGGACCTACAGGAGAGTGAAGTATG[T/A]CAGGATGAATTGGCCCTCAAGGTCCAACAGCTGAAAGCTGAACTTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089386   None 640 None 9
ENSDART00000123011 Essential Splice Site None 614 11 17

The following transcripts of ENSDARG00000062108 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 19176988)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17207311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAACGGCAGAGAAGCATCAAACAATTGCAGCGATAGTTGTCCAGCAG[G/T]TGAGAAAGCATGTTGAGCTGGTACTTTTTTATTAGAATCATATGTGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link