klf5b

Ensembl ID:
ENSDARG00000062106
ZFIN ID:
ZDB-GENE-080424-4
Description:
Novel Kruppel-like factor protein [Source:UniProtKB/TrEMBL;Acc:B8JL64]
Human Orthologue:
KLF5
Human Description:
Kruppel-like factor 5 (intestinal) [Source:HGNC Symbol;Acc:6349]
Mouse Orthologue:
Klf5
Mouse Description:
Kruppel-like factor 5 Gene [Source:MGI Symbol;Acc:MGI:1338056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25428 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089403 Nonsense 211 345 1 3
ENSDART00000146300 Nonsense 210 344 2 4
Genomic Location (Zv9):
Chromosome 9 (position 31839342)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30995288
KASP Assay ID:
554-7744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCACCCAACTCAGAACCGGGCAGCCCGGACAGGAGGAAAGAGCTCATA[C/T]AGAACTTATCGCCACCTCCGTCATATGCTGCTAGCATGGCATCAAAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link