ankrd24

Ensembl ID:
ENSDARG00000062103
ZFIN ID:
ZDB-GENE-050208-747
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LX20]
Human Orthologue:
ANKRD24
Human Description:
ankyrin repeat domain 24 [Source:HGNC Symbol;Acc:29424]
Mouse Orthologue:
Ankrd24
Mouse Description:
ankyrin repeat domain 24 Gene [Source:MGI Symbol;Acc:MGI:1890394]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12094 Essential Splice Site, Missense Available for shipment Available now
sa3188 Nonsense F2 line generated During 2014
sa19294 Nonsense Mutation detected in F1 DNA During 2014
sa10909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089348 Essential Splice Site 646 950 20 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 None None 77 None 3
ENSDART00000144648 Missense 77 220 1 2
Genomic Location:
Chromosome 22 (position 21688602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGARTTGAAGGAGAGCGTCCCTCGAGGTCAGTTTGAAGAGGTTCAG[G/A]TCACTTTAGGCCTTCAGCTTAAYCAGTTAGCTCAAGAACGTGCYGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3188
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089348 None None 950 None 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 None None 77 None 3
ENSDART00000144648 Nonsense 96 220 1 2
ENSDART00000089348 None None 950 None 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 None None 77 None 3
ENSDART00000144648 Nonsense 96 220 1 2
Genomic Location:
Chromosome 22 (position 21688545)
KASP Assay ID:
554-3274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCCTTCAGCTTAATCAGTTAGCTCAAGAACGTGCCGAAGTGGCTGCT[C/T]GACTCAACCAGGCCTTGCTGGAGCTGGAAAGGCTCCGACCCCCATCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089348 Nonsense 928 950 26 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 Nonsense 59 77 3 3
ENSDART00000144648 None None 220 None 2
ENSDART00000089348 Nonsense 928 950 26 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 Nonsense 59 77 3 3
ENSDART00000144648 None None 220 None 2
Genomic Location:
Chromosome 22 (position 21681221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGTCTTAAATCATGATGTCTTTTTGTCTTAATAGGGCCGTATGGAT[G/T]AAGAAGTTCAAGCGCTTTTGCTTCAAATCCTCCGTATGACACAGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089348 Nonsense 928 950 26 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 Nonsense 59 77 3 3
ENSDART00000144648 None None 220 None 2
ENSDART00000089348 Nonsense 928 950 26 27
ENSDART00000131476 None None 212 None 7
ENSDART00000139817 Nonsense 59 77 3 3
ENSDART00000144648 None None 220 None 2
Genomic Location:
Chromosome 22 (position 21681221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATRTCTTAAATCATGATGTCTTTTTGTCTTAATAGGGCCGTATGGAT[G/T]AAGAAGTTCAAGCGCTTTTGCTTCAAATCCTCCGTATGACACAGAAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n0g2l2p2