uggt2

Ensembl ID:
ENSDARG00000062089
ZFIN ID:
ZDB-GENE-050517-21
Description:
Im:7146988 protein [Source:UniProtKB/TrEMBL;Acc:A3KNY0]
Human Orthologue:
UGGT2
Human Description:
UDP-glucose glycoprotein glucosyltransferase 2 [Source:HGNC Symbol;Acc:15664]
Mouse Orthologue:
Uggt2
Mouse Description:
UDP-glucose glycoprotein glucosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1913685]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16689 Nonsense Available for shipment Available now
sa5545 Nonsense Mutation detected in F1 DNA During 2014
sa13827 Nonsense Available for shipment Available now
sa7187 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Nonsense 75 575 4 17
ENSDART00000125632 Nonsense 75 1527 4 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30466770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAWGCTGATATGTACTTTTCTGTCTTTAGAGTCTGTCCGCTCCTATTA[T/A]AACCTGATCCTCAAGAAGGCTGGCCARTTTTTGACGGATCTTCAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 Nonsense 473 575 14 17
ENSDART00000125632 Nonsense 473 1527 14 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30476765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGAGCAACATTTCCCGGTGTTATTCGACAAATACGCCGTAACTTCTA[T/A]AACCTGGTGAGTCAGCTTGTTTGTGAGTTGATTATAGTGTAAGCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 None None 575 None 17
ENSDART00000125632 Nonsense 588 1527 17 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30478167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTCCAAAAGCAAATGCTGCCAGAATTCTTGGAGTGGATTCAAGCTA[T/A]GATGACAACAGGAAGGTAATGTTRTTAGAAAGCATTATGNNNNNCATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089354 None None 575 None 17
ENSDART00000125632 Essential Splice Site 1072 1527 28 41

The following transcripts of ENSDARG00000062089 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30497377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCCGTCAGAAGCCCATATGAWCTAGATAACATCCACCTACAAGAGG[T/G]ATGAACTCTTAATSCAGCATTTATANNNNNTACAATGGTAGGTTAGCCCCTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/78xtsqbm