si:dkey-177f24.1

Ensembl ID:
ENSDARG00000062086
ZFIN ID:
ZDB-GENE-050419-18
Description:
Novel protein similar to human G2 protein (G2) [Source:UniProtKB/TrEMBL;Acc:Q1LV92]
Human Orthologue:
C11orf41
Human Description:
chromosome 11 open reading frame 41 [Source:HGNC Symbol;Acc:24836]
Mouse Orthologue:
D430041D05Rik
Mouse Description:
RIKEN cDNA D430041D05 gene Gene [Source:MGI Symbol;Acc:MGI:2181743]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39204 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9549 Nonsense Available for shipment Available now
sa36670 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Essential Splice Site 57 961 1 16
ENSDART00000089615   None 126 None 2
ENSDART00000132342   None 584 None 11
Genomic Location (Zv9):
Chromosome 18 (position 27959587)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28032439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTAGCAATATTCTTACTTTTATTACACAACGCGCAGGCTTCTGACGG[T/C]AAGTCGATGTTTTATTTTTATTTTTATGTTGAACCGACACTTTAAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Nonsense 108 961 2 16
ENSDART00000089615   None 126 None 2
ENSDART00000132342   None 584 None 11
Genomic Location (Zv9):
Chromosome 18 (position 28013476)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28086328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGTAGTCCAATCAGATCCTAAAGGCTCATCAAAGAGCAGAAGGGAA[C/T]AACCTGCCTTTTCCTCTWTTCTCACACTACTTGCCAGCACAGCCCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089349 Essential Splice Site 565 961 9 16
ENSDART00000089615   None 126 None 2
ENSDART00000132342 Essential Splice Site 195 584 5 11
Genomic Location (Zv9):
Chromosome 18 (position 28064011)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 28136863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGTCTTCTGTCCATGCCCATTAAAGTCCTTTTTCTCCGTGTTCTTGC[A/T]GTGATTCAGGATGTGTCAAACTCATCTCTGGAAGTGCAATACCAGAGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link