si:dkey-14o18.5

Ensembl ID:
ENSDARG00000062084
ZFIN ID:
ZDB-GENE-060503-333
Description:
chloride channel 1, skeletal muscle [Source:RefSeq peptide;Acc:NP_001076379]
Human Orthologue:
CLCN1
Human Description:
chloride channel 1, skeletal muscle [Source:HGNC Symbol;Acc:2019]
Mouse Orthologue:
Clcn1
Mouse Description:
chloride channel 1 Gene [Source:MGI Symbol;Acc:MGI:88417]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23449 Nonsense Available for shipment Available now
sa32234 Nonsense Available for shipment Available now
sa12840 Essential Splice Site Available for shipment Available now
sa17158 Essential Splice Site Available for shipment Available now
sa10992 Essential Splice Site Available for shipment Available now
sa16717 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Nonsense 92 1011 2 23
ENSDART00000133359 Nonsense 26 945 2 23
Genomic Location (Zv9):
Chromosome 19 (position 10270856)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9729395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATCTGGATCTGGAGATAGGGAGCATTCATGATAGACCAGAGGAGGAG[C/T]AGGGCCACACGTCGTCCTTCAAGAAACGCCGCTCTTACTCCAAATGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Nonsense 459 1011 12 23
ENSDART00000133359 Nonsense 393 945 12 23
Genomic Location (Zv9):
Chromosome 19 (position 10252854)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9711393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATATGGGGATCCCCCCTCCCGCCGGGACTCGGACGCTCTGCTGTGTG[G/A]TTTCATCCTGACGTCAGCATCTTTGTCATTCTTATCCTCTTTTTGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Essential Splice Site 477 1011 12 23
ENSDART00000133359 Essential Splice Site 411 945 12 23
Genomic Location (Zv9):
Chromosome 19 (position 10252798)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9711337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGACGTCAGCATCTTTGTCATTCTTATCCTCTTTTTGATCATGAAGG[T/C]TGGTTGATTTTAATCTTCATCAGTTGTCTYTAATGTATATATCMTATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Essential Splice Site 747 1011 18 23
ENSDART00000133359 Essential Splice Site 681 945 18 23
ENSDART00000041094 Essential Splice Site 747 1011 18 23
ENSDART00000133359 Essential Splice Site 681 945 18 23
Genomic Location (Zv9):
Chromosome 19 (position 10239305)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9697844
KASP Assay ID:
2261-2975.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCCCCGCCCAAACCTTCAGAACCGTCCAYCAATCACACGTCKYCTGG[T/C]GAGAAACGCTCAGACATTACTGAACTGTCCACTTTAAAACCTTAATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Essential Splice Site 747 1011 18 23
ENSDART00000133359 Essential Splice Site 681 945 18 23
ENSDART00000041094 Essential Splice Site 747 1011 18 23
ENSDART00000133359 Essential Splice Site 681 945 18 23
Genomic Location (Zv9):
Chromosome 19 (position 10239305)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9697844
KASP Assay ID:
2261-2975.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCCCCGCCCAAACCTTCAGAACCGTCCACCAATCACACGTCKYCTGG[T/C]GAGAAACGCTCAGACATTACTGAACTGTCCACTTTAAAACCTTAATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041094 Essential Splice Site 854 1011 22 23
ENSDART00000133359 Essential Splice Site 788 945 22 23
Genomic Location (Zv9):
Chromosome 19 (position 10238147)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9696686
KASP Assay ID:
2261-2974.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTATGTAACCAATACTGGAAAATTWGTGGGAGTCGTGGCRCTGAAAGAG[G/A]TAGGCCATTCAYCCATCCATCCATCCATRKACTCATTCACCTTCCTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link