tbc1d1

Ensembl ID:
ENSDARG00000062081
ZFIN ID:
ZDB-GENE-060710-1
Description:
Tbc1d1 protein [Source:UniProtKB/TrEMBL;Acc:Q29R86]
Human Orthologue:
TBC1D1
Human Description:
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 [Source:HGNC Symbol;Acc:11578]
Mouse Orthologue:
Tbc1d1
Mouse Description:
TBC1 domain family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1889508]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8796 Nonsense Mutation detected in F1 DNA During 2014
sa18692 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294 None None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21
ENSDART00000089294 None None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17511981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCACAACAGCCAAGAGCCCAGCTATTTTGGCTGTCTGCTCAGAGAG[G/T]AGAAAAAARCAGCCTGCTATGTATTCCGCTGCCAGGACCAGCTGAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294 None None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21
ENSDART00000089294 None None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 17511981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCACAACAGCCAAGAGCCCAGCTATTTTGGCTGTCTGCTCAGAGAG[G/T]AGAAAAAAGCAGCCTGCTATGTATTCCGCTGCCAGGACCAGCTGAAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7k005spp