tbc1d1

Ensembl ID:
ENSDARG00000062081
ZFIN ID:
ZDB-GENE-060710-1
Description:
Tbc1d1 protein [Source:UniProtKB/TrEMBL;Acc:Q29R86]
Human Orthologue:
TBC1D1
Human Description:
TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 [Source:HGNC Symbol;Acc:11578]
Mouse Orthologue:
Tbc1d1
Mouse Description:
TBC1 domain family, member 1 Gene [Source:MGI Symbol;Acc:MGI:1889508]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32643 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8796 Nonsense Mutation detected in F1 DNA During 2016
sa18692 Nonsense Mutation detected in F1 DNA During 2016
sa32642 Nonsense Available for shipment Available now
sa32641 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294   None 1057 None 20
ENSDART00000089328 Essential Splice Site 68 658 None 13
ENSDART00000133194 Essential Splice Site 69 1253 None 23
ENSDART00000147525 Essential Splice Site 69 1213 None 22
ENSDART00000147645 Essential Splice Site 69 1180 None 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17513929)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18079097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGAGAAGAACAGAAACCTTGAGTTCAATGGCAATTACTCTCCCGAGG[T/G]CAGTGTAATTCAAATATGTTGGGTGTAATGTAAAAAAGATATGAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294   None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21
ENSDART00000089294   None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17511981)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18077149
KASP Assay ID:
2259-0400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCACAACAGCCAAGAGCCCAGCTATTTTGGCTGTCTGCTCAGAGAG[G/T]AGAAAAAARCAGCCTGCTATGTATTCCGCTGCCAGGACCAGCTGAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294   None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21
ENSDART00000089294   None 1057 None 20
ENSDART00000089328 Nonsense 132 658 2 13
ENSDART00000133194 Nonsense 133 1253 2 23
ENSDART00000147525 Nonsense 133 1213 2 22
ENSDART00000147645 Nonsense 133 1180 2 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17511981)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18077149
KASP Assay ID:
2259-0400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCACAACAGCCAAGAGCCCAGCTATTTTGGCTGTCTGCTCAGAGAG[G/T]AGAAAAAAGCAGCCTGCTATGTATTCCGCTGCCAGGACCAGCTGAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294 Nonsense 43 1057 2 20
ENSDART00000089328 Nonsense 165 658 3 13
ENSDART00000133194 Nonsense 166 1253 3 23
ENSDART00000147525 Nonsense 166 1213 3 22
ENSDART00000147645 Nonsense 166 1180 3 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17468492)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18033660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGAGATCATCAGCACTCTCAGACAGGCTGGCAAAAGCTCTGCCCGG[C/T]AAGAAGACACTCCATCACTGCCTAGCAACGGTCAATCAGATGCCTCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089294 Nonsense 255 1057 6 20
ENSDART00000089328 Nonsense 377 658 7 13
ENSDART00000133194 Nonsense 378 1253 7 23
ENSDART00000147525 Nonsense 378 1213 7 22
ENSDART00000147645 Nonsense 378 1180 7 21

The following transcripts of ENSDARG00000062081 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17458192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18023360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAAAAGTTTCAGCTCAGAGCTGCTGTGTTCTTCATGTTCAGGTGGAT[G/T]AGATCATGTTGACTTTGAAGCAGGCGTTCTCTGTGGCCGCTCTCCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link