shc2

Ensembl ID:
ENSDARG00000062080
ZFIN ID:
ZDB-GENE-050208-666
Description:
SHC-transforming protein 2 [Source:RefSeq peptide;Acc:NP_001038438]
Human Orthologue:
SHC2
Human Description:
SHC (Src homology 2 domain containing) transforming protein 2 [Source:HGNC Symbol;Acc:29869]
Mouse Orthologue:
Shc2
Mouse Description:
SHC (Src homology 2 domain containing) transforming protein 2 Gene [Source:MGI Symbol;Acc:MGI:106180

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37506 Nonsense Mutation detected in F1 DNA During 2017
sa39370 Essential Splice Site Mutation detected in F1 DNA During 2017
sa3162 Essential Splice Site, Splice Site F2 line generated During 2017
sa32400 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089286 Nonsense 11 572 1 14
ENSDART00000132605   None 501 None 13
Genomic Location (Zv9):
Chromosome 22 (position 21647853)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21301101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCTTCAGCCCAGGTGTTGGCTGACTCGCCCGGGATGGACAGCGAG[C/T]AGGATGGCACCACCACCTTCTGCATGCTCATCCCCAAAATGCCCCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089286 Essential Splice Site 128 572 4 14
ENSDART00000132605 Essential Splice Site 48 501 3 13
Genomic Location (Zv9):
Chromosome 22 (position 21656027)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21309275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAGACTGATTGAGTGTACTAATGAGAGTGTCTCTTGTTTTTATTGC[A/G]GTACATGGGCTGCATTGAGGTCCTCAAATCCATGAGATCGTTGGACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3162
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089286 Splice Site None 572 None 14
ENSDART00000132605 Essential Splice Site 167 501 7 13
Genomic Location (Zv9):
Chromosome 22 (position 21663571)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21316819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCTGATTACGTCGCCTATGTAGCCAAAGACCCCGTCAACCAAAGAGG[T/C]ATATTTATTATTTATTTGTATATATTTTTAATAAGGTTTATTTGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089286 Nonsense 539 572 14 14
ENSDART00000132605 Nonsense 468 501 13 13
Genomic Location (Zv9):
Chromosome 22 (position 21673139)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21326387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAATAATTCCTTATTTCTTCTAGGTCCGAACTAAAGACATGCTTTTC[G/T]AGAGCATCAGTCACCTGATCAACTACCATCTGACAAACAAGCTGCCGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link