hs2st1a

Ensembl ID:
ENSDARG00000062078
ZFIN ID:
ZDB-GENE-070112-2312
Description:
heparan sulfate 2-O-sulfotransferase 1 [Source:RefSeq peptide;Acc:NP_001074139]
Human Orthologue:
HS2ST1
Human Description:
heparan sulfate 2-O-sulfotransferase 1 [Source:HGNC Symbol;Acc:5193]
Mouse Orthologue:
Hs2st1
Mouse Description:
heparan sulfate 2-O-sulfotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1346049]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14728 Nonsense Available for shipment Available now
sa11765 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089327 Nonsense 176 354 4 7

The following transcripts of ENSDARG00000062078 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23156843)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGTTATCCGAGACCCCATTGAGCGTCTGGTGTCATACTATTATTTCCTG[C/T]GATTTGGAGATGATTACAGACCGGGYCTAMGACGCAGAAAACAAGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089327 Essential Splice Site 279 354 6 7

The following transcripts of ENSDARG00000062078 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23154931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGCTCTTCCTCGCTTCTTTAAAGGGGCCACAGAACTCTATAAGACGG[G/A]TATGAMTGCATAGACTNNGTGAATTNACATTTTAAWACTATATTTTCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mxlqu9fh