LOC100006023

Ensembl ID:
ENSDARG00000062077
Human Orthologue:
ACSBG1
Human Description:
acyl-CoA synthetase bubblegum family member 1 [Source:HGNC Symbol;Acc:29567]
Mouse Orthologue:
Acsbg1
Mouse Description:
acyl-CoA synthetase bubblegum family member 1 Gene [Source:MGI Symbol;Acc:MGI:2385656]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38089 Nonsense Mutation detected in F1 DNA During 2017
sa38088 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089332 Nonsense 318 674 8 13
Genomic Location (Zv9):
Chromosome 25 (position 27027573)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25901284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACATGAAATTTTATGGTAAATTTTAGGGGACTTTGGTGGACTCACTA[C/T]GAGAGGTGACTCCCACAGCCCACATGGGTGTTCCCCGTGTTTGGGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089332 Essential Splice Site 567 674 11 13
Genomic Location (Zv9):
Chromosome 25 (position 27024991)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25898702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAATTGGTGACGAAAGGAAATTTTTGTCCATGCTGCTAACACTAAAGG[T/A]ATATTATGCTTTAAAAAAGTTCTTGCTTTAACACTTCCAAAACCACTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Personality dimensions: A genome-wide association study of Cloninger's temperament scales: implications for the evolutionary genetics of personality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link