tab3

Ensembl ID:
ENSDARG00000062063
ZFIN ID:
ZDB-GENE-060503-408
Description:
TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 [Source:RefSeq peptide;Acc:NP_001038570]
Human Orthologue:
TAB3
Human Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 3 [Source:HGNC Symbol;Acc:30681]
Mouse Orthologue:
Tab3
Mouse Description:
TGF-beta activated kinase 1/MAP3K7 binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1913974]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12767 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089274 Essential Splice Site None 573 2 7
Genomic Location:
Chromosome 8 (position 19069706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGGCTTGATTTGAGTGTCTGACATGATGTTACTGGTGTGTGTTGTCA[G/T]GGGATGAGAGGAGAGCAGGTGCTGCGCTCCTGGCTGCGGACTCATTGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/el9696ow