si:ch211-245h7.5

Ensembl ID:
ENSDARG00000062060
ZFIN ID:
ZDB-GENE-060503-35
Description:
Novel protein similar to vertebrate glucocorticoid modulatory element binding protein 1 (GMEB1) [Sou
Human Orthologue:
GMEB1
Human Description:
glucocorticoid modulatory element binding protein 1 [Source:HGNC Symbol;Acc:4370]
Mouse Orthologue:
Gmeb1
Mouse Description:
glucocorticoid modulatory element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2135604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10578 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103767 Essential Splice Site 186 584 None 9
ENSDART00000138709 Essential Splice Site 186 543 None 9
ENSDART00000144376 Essential Splice Site 49 176 None 7
Genomic Location (Zv9):
Chromosome 19 (position 15510874)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 16174478
KASP Assay ID:
2261-3119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTCCCACCRGACGGCAGCGGCCTCAACACACCCATTACAGCTGCAGG[T/C]TAGAAHACAGGCACTAATGTWGGCTTTTCACTTTGTGTGGGAATTGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link