si:ch211-236l14.4

Ensembl ID:
ENSDARG00000062059
ZFIN ID:
ZDB-GENE-081104-189
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZCZ7]
Human Orthologue:
KIAA1161
Human Description:
KIAA1161 [Source:HGNC Symbol;Acc:19918]
Mouse Orthologue:
AI464131
Mouse Description:
expressed sequence AI464131 Gene [Source:MGI Symbol;Acc:MGI:2140300]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17442 Nonsense Available for shipment Available now
sa14522 Nonsense Available for shipment Available now
sa13364 Nonsense Available for shipment Available now
sa25227 Nonsense Mutation detected in F1 DNA During 2017
sa44311 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8947 Nonsense Mutation detected in F1 DNA During 2017
sa12534 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 28 693 1 10
ENSDART00000136598   None 456 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 24468533)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23647646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCCAGAGGTGACATGGGACACGGGCTTGAAAGAGATGAACGAGACCT[G/A]GAAGGGCGCAATTGCTTGCTTGGGAGTCGCTGTGTTTTTTGTCATGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 269 693 3 10
ENSDART00000136598 Nonsense 55 456 1 8
Genomic Location (Zv9):
Chromosome 25 (position 24422178)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23601291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTGTGTGGGACACAACATTAAAGTTGTCYATCAAGAGTCAATGCGA[C/T]AGCTCTCCACAAYCAGACGAGAGCTGCCAAACATGGATGTCTWACGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 283 693 3 10
ENSDART00000136598 Nonsense 69 456 1 8
Genomic Location (Zv9):
Chromosome 25 (position 24422135)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23601248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCGAYAGCTCTCCACAAYCAGACGAGAGCTGCCAAACATGGATGTCT[T/A]ACGGTACAGCACCTTTRCAAACATTWATTTCWCTGTATTTCAGTAATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 436 693 6 10
ENSDART00000136598 Nonsense 199 456 4 8
Genomic Location (Zv9):
Chromosome 25 (position 24400363)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23579476
KASP Assay ID:
554-7477.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCCACGACTTGGTTTCTGGACAAAGTGGACAGCTTACATAGCCATT[T/A]GGGCATGGAGTATGTCATCCTGGAAGGCGGTGAGGGAAACCCTTTTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Essential Splice Site 489 693 6 10
ENSDART00000136598 Essential Splice Site 252 456 4 8
Genomic Location (Zv9):
Chromosome 25 (position 24400202)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23579315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGGCAGAGAGGATAGGGGACAATGCTATTGTGACCTCAGGAACAAGG[T/C]ATTTGGTACAAATCAATTACTTTTATTTGGCCAACTAGAACACAAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 583 693 9 10
ENSDART00000136598 Nonsense 346 456 7 8
Genomic Location (Zv9):
Chromosome 25 (position 24389578)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23568691
KASP Assay ID:
2261-9745.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATYAAGMATTCACTTTTCTGTCTAGGTTCTAAACCTCACCAGGTTCTA[C/A]ATAGCCAAGCATCATGACTTCGTAGTTCCTYTGATACTGAAATACGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089278 Nonsense 614 693 9 10
ENSDART00000136598 Nonsense 377 456 7 8
Genomic Location (Zv9):
Chromosome 25 (position 24389485)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23568598
KASP Assay ID:
2261-9744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGCAGACGAATGGCAAGAGACWGGAAACCCCATCTACAGACCACTGTG[G/A]TGGCTTAGTCCAAATGACCYAATCACTTTCAGCATTGATGATGAGTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link