elmod1

Ensembl ID:
ENSDARG00000062056
ZFIN ID:
ZDB-GENE-070112-262
Description:
ELMO domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001074150]
Human Orthologue:
ELMOD1
Human Description:
ELMO/CED-12 domain containing 1 [Source:HGNC Symbol;Acc:25334]
Mouse Orthologue:
Elmod1
Mouse Description:
ELMO domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3583900]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu7879 Nonsense Available for shipment Available now
sa9697 Essential Splice Site Available for shipment Available now
sa37293 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
hu7879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089246 Nonsense 226 230 8 8
ENSDART00000122389   None 328 None 10
ENSDART00000134715   None 327 None 11
ENSDART00000135410   None 123 None 5
ENSDART00000139789   None 141 None 7

The following transcripts of ENSDARG00000062056 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 21058912)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22070405
KASP Assay ID:
554-2417.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTCATTTACAGTACATTGTTTTATCCCTCGAAAAAGCCCGCTAAATT[T/G]AAYTAATGCACTTTAAGAYGCCATTAAGCTTTAAATGCATGRGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089246   None 230 None 8
ENSDART00000122389 Essential Splice Site 226 328 8 10
ENSDART00000134715 Essential Splice Site 225 327 9 11
ENSDART00000135410   None 123 None 5
ENSDART00000139789   None 141 None 7

The following transcripts of ENSDARG00000062056 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 21058297)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22069790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGAGCAAAGCTGAATGGGAAAAGAAGAAATTCRACAAAGCGATCGGG[T/C]GAGTTCAGAAAANNNNTTNNAAACTATTGTGCATACTCACATTGAGGTCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089246   None 230 None 8
ENSDART00000122389 Nonsense 254 328 9 10
ENSDART00000134715 Nonsense 253 327 10 11
ENSDART00000135410   None 123 None 5
ENSDART00000139789   None 141 None 7

The following transcripts of ENSDARG00000062056 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 21056469)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22067962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGGCCTATTCCCTGCTGGTGAGCGGAGCTCTGAAGACTCATCTGTA[T/A]AATGTGGCACCAGAGATGCCAAGCCTAGTGCACTTCCAACAGACCTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link