elmod1

Ensembl ID:
ENSDARG00000062056
ZFIN ID:
ZDB-GENE-070112-262
Description:
ELMO domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001074150]
Human Orthologue:
ELMOD1
Human Description:
ELMO/CED-12 domain containing 1 [Source:HGNC Symbol;Acc:25334]
Mouse Orthologue:
Elmod1
Mouse Description:
ELMO domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3583900]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu7879 Nonsense Available for shipment Available now
sa9697 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
hu7879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089246 Nonsense 226 230 8 8
ENSDART00000122389 None None 328 None 10
ENSDART00000134715 None None 327 None 11
ENSDART00000135410 None None 123 None 5
ENSDART00000139789 None None 141 None 7

The following transcripts of ENSDARG00000062056 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 21058912)
KASP Assay ID:
554-2417.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTCATTTACAGTACATTGTTTTATCCCTCGAAAAAGCCCGCTAAATT[T/G]AAYTAATGCACTTTAAGAYGCCATTAAGCTTTAAATGCATGRGCAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089246 None None 230 None 8
ENSDART00000122389 Essential Splice Site 226 328 8 10
ENSDART00000134715 Essential Splice Site 225 327 9 11
ENSDART00000135410 None None 123 None 5
ENSDART00000139789 None None 141 None 7

The following transcripts of ENSDARG00000062056 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 21058297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGAGCAAAGCTGAATGGGAAAAGAAGAAATTCRACAAAGCGATCGGG[T/C]GAGTTCAGAAAANNNNTTNNAAACTATTGTGCATACTCACATTGAGGTCCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z9t8z3mo