si:dkey-20n3.1

Ensembl ID:
ENSDARG00000062055
ZFIN ID:
ZDB-GENE-030131-8693
Human Orthologue:
RNF38
Human Description:
ring finger protein 38 [Source:HGNC Symbol;Acc:18052]
Mouse Orthologue:
Rnf38
Mouse Description:
ring finger protein 38 Gene [Source:MGI Symbol;Acc:MGI:1920719]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8465 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44506 Nonsense Mutation detected in F1 DNA During 2018
sa11481 Nonsense Available for shipment Available now
sa44507 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Essential Splice Site 198 673 2 13
ENSDART00000139241 Essential Splice Site 198 673 3 13
Genomic Location (Zv9):
Chromosome 1 (position 17636570)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18201738
GRCz11 1 18894675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTACCACTATCATTCAGAGCATGCGTGCGCAGATGCCACTGACAAG[G/A]TAAGACATCCTCAATGCTTATAGCCTGCAATGTAGACAAATAAACCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Nonsense 458 673 6 13
ENSDART00000139241 Nonsense 458 673 7 13
Genomic Location (Zv9):
Chromosome 1 (position 17666262)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18231430
GRCz11 1 18924367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGCCACACCTTCCTACTCCGGGACAGTTCTTACCCTTCCAAGCGCAA[C/T]AGTCCCGATCTGTGAGCATTATATGTTTTTGTAAAATAGCATTCAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Nonsense 517 673 8 13
ENSDART00000139241 Nonsense 517 673 9 13
Genomic Location (Zv9):
Chromosome 1 (position 17668204)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18233372
GRCz11 1 18926309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAAACAAGTTAATGAATCTTRTGTTTTYCTGTGCGTTCTGTCCAGCCGTA[T/A]CCTCACTTCATGCCACGGCGAATCACAGGCAGACGCTACCGCTCTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089233 Essential Splice Site 550 673 8 13
ENSDART00000139241 Essential Splice Site 550 673 9 13
Genomic Location (Zv9):
Chromosome 1 (position 17668304)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18233472
GRCz11 1 18926409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCGTACCGCCACCTCCTTACCACCCTAGTCTGCTGCCCTACTTCCTG[T/A]GAGTTACACATACTCGCCTACACCAGAGCTTTGTGCTTAGTGATGTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link