kbp

Ensembl ID:
ENSDARG00000062053
ZFIN ID:
ZDB-GENE-070117-1989
Description:
KIF1-binding protein homolog [Source:UniProtKB/Swiss-Prot;Acc:A8WE67]
Human Orthologue:
KIAA1279
Human Description:
KIAA1279 [Source:HGNC Symbol;Acc:23419]
Mouse Orthologue:
2510003E04Rik
Mouse Description:
RIKEN cDNA 2510003E04 gene Gene [Source:MGI Symbol;Acc:MGI:1919570]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12676 Essential Splice Site Available for shipment Available now
sa7723 Nonsense Mutation detected in F1 DNA During 2014
sa24932 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089242 Essential Splice Site 149 631 1 7
Genomic Location:
Chromosome 13 (position 23234752)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGTGCACCACAACACGGGAGAACGTCTCCTTATTTATACATGTCCGG[G/T]TAAATWCACACTANNNNNNCATGGATTATTATTTTCTAAAAAAGCCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089242 Nonsense 475 631 7 7
Genomic Location:
Chromosome 13 (position 23224857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGTCGACATGCTGGAGCCTATCTGCAAGGATCTGAACGCTCAGTACTA[T/A]TTGTTAATCTGCCGGCAGCTGCAGTTTGAACTTGCCGAAACCTAYTACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089242 Nonsense 585 631 7 7
Genomic Location:
Chromosome 13 (position 23224527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAATCTGGCCACCCAAATGGAGAATCTCAGTCTTTCACTGGAGTCCTA[C/A]AACTTCGTAGTGCAGTACTGTGAGGAGAATCCAGAAGCCAAGAACGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m8e7z4he