casp2

Ensembl ID:
ENSDARG00000062052
ZFIN ID:
ZDB-GENE-030825-3
Description:
caspase-2 [Source:RefSeq peptide;Acc:NP_001036160]
Human Orthologue:
CASP2
Human Description:
caspase 2, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1503]
Mouse Orthologue:
Casp2
Mouse Description:
caspase 2 Gene [Source:MGI Symbol;Acc:MGI:97295]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12064 Essential Splice Site Available for shipment Available now
sa13717 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089230 Essential Splice Site 58 242 None 5
ENSDART00000122212 Essential Splice Site 217 437 None 10
ENSDART00000128388 Essential Splice Site 217 399 None 10
ENSDART00000137215 None None 110 None 3
Genomic Location:
Chromosome 16 (position 19622347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGAGCTGGACTTTAAAGTCAGTCTGCACAGAGATCTAACAGYAGAGG[T/G]GAGTTASACATGAATCATGATGCAGTGTGCCCTTTAAAGCATGCTATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089230 None 196 242 4 5
ENSDART00000122212 None 355 437 8 10
ENSDART00000128388 Essential Splice Site 355 399 None 10
ENSDART00000137215 None 28 110 1 3
Genomic Location:
Chromosome 16 (position 19617261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGCCTCAAAGAWCCGATATGATATGTGRCTTTGCAACCCTCAAAGG[T/C]TTCAGTGTGTACACGTTGTATATTAATCATAGGAAATTTATTATCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oy84adza