hmha1

Ensembl ID:
ENSDARG00000062049
ZFIN ID:
ZDB-GENE-071213-2
Description:
Hmha1 protein [Source:UniProtKB/TrEMBL;Acc:A4FVN1]
Human Orthologue:
HMHA1
Human Description:
histocompatibility (minor) HA-1 [Source:HGNC Symbol;Acc:17102]
Mouse Orthologue:
Hmha1
Mouse Description:
histocompatibility (minor) HA-1 Gene [Source:MGI Symbol;Acc:MGI:1917969]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24143 Nonsense Available for shipment Available now
sa37489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089171 Nonsense 604 1126 14 23
ENSDART00000132565 Nonsense 339 861 8 17
Genomic Location (Zv9):
Chromosome 22 (position 17846512)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17597447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGCACCGACAGCGCTAATGCTGAAGCTCAGAGCAGTGCTGAGGTGCCA[C/T]AAACTGCAGGAGAGACTGGAGACACGAGCAGCTCACAGAAAGATGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089171 Nonsense 895 1126 20 23
ENSDART00000132565 Nonsense 630 861 14 17
Genomic Location (Zv9):
Chromosome 22 (position 17841901)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17592836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTCCAGAGGGAGCTGACAGTGGTAAAGGACCAGACCTGATGGACCTT[G/T]GACCTGAGACGGATCCTGAACTCTTGGTCCTCGTGGACAGACTTAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link