il1rapl1a

Ensembl ID:
ENSDARG00000062045
ZFIN ID:
ZDB-GENE-061013-249
Description:
Interleukin-1 receptor accessory protein-like 1-A [Source:UniProtKB/Swiss-Prot;Acc:B6ZK76]
Human Orthologue:
IL1RAPL1
Human Description:
interleukin 1 receptor accessory protein-like 1 [Source:HGNC Symbol;Acc:5996]
Mouse Orthologue:
Il1rapl1
Mouse Description:
interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2687319]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15551 Essential Splice Site Available for shipment Available now
sa21502 Nonsense Mutation detected in F1 DNA During 2014
sa12814 Nonsense Available for shipment Available now
sa13024 Nonsense Available for shipment Available now
sa2524 Nonsense F2 line generated During 2014
sa5821 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa15551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site None 701 2 13
ENSDART00000101171 Essential Splice Site None 716 2 14
ENSDART00000134157 Essential Splice Site 3 744 2 14
ENSDART00000138574 None None 550 None 10
Genomic Location:
Chromosome 9 (position 30963931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTAGTCCGGGCCTGACAACACGAGAYCYTCCTGAAGAATGAATGAG[G/A]TAAGTCTCTCTCTTTTTTTACACAATTGTGYTAACAAACTTGTTCATAAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
Genomic Location:
Chromosome 9 (position 30832342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/A]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location:
Chromosome 9 (position 30755444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location:
Chromosome 9 (position 30755444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2524
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location:
Chromosome 9 (position 30751840)
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5821
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location:
Chromosome 9 (position 30751840)
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/41wguqr0