il1rapl1a

Ensembl ID:
ENSDARG00000062045
ZFIN ID:
ZDB-GENE-061013-249
Description:
Interleukin-1 receptor accessory protein-like 1-A [Source:UniProtKB/Swiss-Prot;Acc:B6ZK76]
Human Orthologue:
IL1RAPL1
Human Description:
interleukin 1 receptor accessory protein-like 1 [Source:HGNC Symbol;Acc:5996]
Mouse Orthologue:
Il1rapl1
Mouse Description:
interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2687319]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15551 Essential Splice Site Available for shipment Available now
sa34668 Nonsense Mutation detected in F1 DNA During 2016
sa21502 Nonsense Mutation detected in F1 DNA During 2016
sa41443 Nonsense Mutation detected in F1 DNA During 2016
sa34667 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12814 Nonsense Available for shipment Available now
sa13024 Nonsense Available for shipment Available now
sa34666 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2524 Nonsense F2 line generated During 2016
sa5821 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa15551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site None 701 2 13
ENSDART00000101171 Essential Splice Site None 716 2 14
ENSDART00000134157 Essential Splice Site 3 744 2 14
ENSDART00000138574   None 550 None 10
Genomic Location:
Chromosome 9 (position 30963931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTAGTCCGGGCCTGACAACACGAGAYCYTCCTGAAGAATGAATGAG[G/A]TAAGTCTCTCTCTTTTTTTACACAATTGTGYTAACAAACTTGTTCATAAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
Genomic Location:
Chromosome 9 (position 30832342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/G]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
ENSDART00000089206 Nonsense 39 701 5 13
ENSDART00000101171 Nonsense 39 716 5 14
ENSDART00000134157 Nonsense 67 744 5 14
ENSDART00000138574 Nonsense 39 550 2 10
Genomic Location:
Chromosome 9 (position 30832342)
KASP Assay ID:
2260-1947.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTTTCTCTCTGCAGTGGACGGCTGCACTGATTGGTCCGTGGACTA[T/G]CTGAAGTACCGGGTGTTACACGGAGAGCCGGTGCGGATAAAGTGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 167 701 6 13
ENSDART00000101171 Nonsense 167 716 6 14
ENSDART00000134157 Nonsense 195 744 6 14
ENSDART00000138574 Nonsense 167 550 3 10
Genomic Location:
Chromosome 9 (position 30825322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGCTACACTGAGAAAGGAGAGCTGGGCAAGAGTAAAGACATCTCCTG[T/A]CCCGATATCCAGGATTACGTTCAGCCTGGAGAAAAACCACAGATAACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site 238 701 8 13
ENSDART00000101171 Essential Splice Site 238 716 8 14
ENSDART00000134157 Essential Splice Site 266 744 8 14
ENSDART00000138574 Essential Splice Site 238 550 5 10
Genomic Location:
Chromosome 9 (position 30797374)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATAACGCTCTGTGTGTGTATGTGTGTGTGTGTGTGTGTTTGTTTCA[G/T]CTCCTCTGACTGAAGAGCCCCCCAGGATTCTGTTTCCCTCTGAAAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location:
Chromosome 9 (position 30755444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
ENSDART00000089206 Nonsense 382 701 11 13
ENSDART00000101171 Nonsense 382 716 11 14
ENSDART00000134157 Nonsense 410 744 11 14
ENSDART00000138574 Nonsense 382 550 8 10
Genomic Location:
Chromosome 9 (position 30755444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGGGCTGGGTGCGATTCWCCTGCTGTTGGCGTTGTTATTGTCTGTGTA[T/A]AAATGCTACAGGATTGAGCTGCTGCTGTGCTACAGGCATCACTTCGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Essential Splice Site 404 701 11 13
ENSDART00000101171 Essential Splice Site 404 716 11 14
ENSDART00000134157 Essential Splice Site 432 744 11 14
ENSDART00000138574 Essential Splice Site 404 550 8 10
Genomic Location:
Chromosome 9 (position 30755376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCTGTGCTACAGGCATCACTTCGGAGGAGAGGATACAGACGGAG[G/A]TAAACGCTGCACACAGGACTTGCTGAGCATAACGCTGCAAGAATTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2524
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location:
Chromosome 9 (position 30751840)
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5821
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
ENSDART00000089206 Nonsense 533 701 13 13
ENSDART00000101171 Nonsense 548 716 14 14
ENSDART00000134157 Nonsense 576 744 14 14
ENSDART00000138574 Nonsense 533 550 10 10
Genomic Location:
Chromosome 9 (position 30751840)
KASP Assay ID:
554-3393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCGATCTGCGAGGAGTCATTAACTACCAGGAGGTGGAAGAGTTAAAA[C/T]AATCCATTAAATGCTTRAGTGTGGTGCACTGGAACGGCCCGCAGAGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link