NP_001099135.1

Ensembl ID:
ENSDARG00000062044
Description:
CDK5 and ABL1 enzyme substrate 1 [Source:RefSeq peptide;Acc:NP_001099135]
Human Orthologue:
CABLES1
Human Description:
Cdk5 and Abl enzyme substrate 1 [Source:HGNC Symbol;Acc:25097]
Mouse Orthologue:
Cables1
Mouse Description:
CDK5 and Abl enzyme substrate 1 Gene [Source:MGI Symbol;Acc:MGI:1927065]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30379 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089207 Essential Splice Site 227 525 3 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 56947)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4484717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCCACTTCATTAAAAACATAAGACAGCATGATATGCGCAATGGAAGG[T/A]ATGCATTACATCAAACCCAACAACCCACACACAGACTCTCAGAGAACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Smoking behavior: Genome-wide and candidate gene association study of cigarette smoking behaviors. (View Study)
  • Tuberculosis: Genome-wide association analyses identifies a susceptibility locus for tuberculosis on chromosome 18q11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link