mthfsd

Ensembl ID:
ENSDARG00000062042
ZFIN ID:
ZDB-GENE-030131-3513
Description:
Methenyltetrahydrofolate synthase domain-containing protein [Source:UniProtKB/Swiss-Prot;Acc:Q0P464]
Human Orthologue:
MTHFSD
Human Description:
methenyltetrahydrofolate synthetase domain containing [Source:HGNC Symbol;Acc:25778]
Mouse Orthologue:
Mthfsd
Mouse Description:
methenyltetrahydrofolate synthetase domain containing Gene [Source:MGI Symbol;Acc:MGI:2679252]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29053 Nonsense Mutation detected in F1 DNA During 2017
sa43127 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099326 Nonsense 21 382 2 8
ENSDART00000123091 Nonsense 21 382 3 9
ENSDART00000139398 Nonsense 12 244 1 6
ENSDART00000146041   None 181 None 6
Genomic Location (Zv9):
Chromosome 18 (position 30859668)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30937128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTGACTTGTAGGGGAAACGAAATGGGATGTGCGTCATAAAGTATG[G/A]AACTACATTGAGGTGAAAAACCTTGCCAATTTTCCACGGCCTGTGCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099326 Essential Splice Site 188 382 6 8
ENSDART00000123091 Essential Splice Site 188 382 7 9
ENSDART00000139398 Essential Splice Site 179 244 5 6
ENSDART00000146041 Essential Splice Site 116 181 5 6
Genomic Location (Zv9):
Chromosome 18 (position 30863552)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30941012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGTGACTGAATCCACTTGGGTCATTACTGTTGTTCATGATTGCCAG[G/A]TTAGTAATGTAGTCTGTAATAACTCTTTGAGTTTCTTAAAACAAAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link