si:ch211-250o15.1

Ensembl ID:
ENSDARG00000062040
ZFIN ID:
ZDB-GENE-060531-48
Description:
Novel protein similar to vertebrate ATPase, Class I, type 8B family [Source:UniProtKB/TrEMBL;Acc:A2B
Mouse Orthologue:
Atp8b5
Mouse Description:
ATPase, class I, type 8B, member 5 Gene [Source:MGI Symbol;Acc:MGI:2444287]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10847 Nonsense Available for shipment Available now
sa33561 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089173 Nonsense 77 1155 4 27
ENSDART00000139401 Nonsense 68 1228 3 25
Genomic Location (Zv9):
Chromosome 5 (position 21048551)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18761423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTTTGTTTGTGTGTTKTAGGTTMTTCCTGCTATTTCTTCTCTGTCTTG[G/A]TTCACCACTGTCGTCCCGCTAGTGTTAGTATTATCGGTGACTGCAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089173 Essential Splice Site 412 1155 None 27
ENSDART00000139401   439 1228 11 25
Genomic Location (Zv9):
Chromosome 5 (position 21060388)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18773260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACATTAAGAGACTATTTGAAGTTAAAAGTATGTCTTCTCTGCCCTAC[A/T]GGAGATGTTTTCCAGCACTACAGTGGACAGACGCTGGAGATCACAGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link