si:ch73-194h10.4

Ensembl ID:
ENSDARG00000062030
ZFIN ID:
ZDB-GENE-100922-133
Human Orthologue:
GPR17
Human Description:
G protein-coupled receptor 17 [Source:HGNC Symbol;Acc:4471]
Mouse Orthologue:
Gpr17
Mouse Description:
G protein-coupled receptor 17 Gene [Source:MGI Symbol;Acc:MGI:3584514]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089195 Nonsense 5 339 1 1
Genomic Location (Zv9):
Chromosome 6 (position 27832634)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28133845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACAACTGTGCATATTCTTCTGTTTTCAGNTATAAAATGGAGTCCTCCT[T/A]GACAGAACTTCCCACCTTGCTGCCCAACCAGTCCATGGACAGCTGCCYAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link