cpox

Ensembl ID:
ENSDARG00000062025
ZFIN IDs:
ZDB-GENE-030131-9884, ZDB-GENE-030131-9884
Description:
coproporphyrinogen-III oxidase, mitochondrial [Source:RefSeq peptide;Acc:NP_001035183]
Human Orthologue:
CPOX
Human Description:
coproporphyrinogen oxidase [Source:HGNC Symbol;Acc:2321]
Mouse Orthologue:
Cpox
Mouse Description:
coproporphyrinogen oxidase Gene [Source:MGI Symbol;Acc:MGI:104841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21253 Nonsense Mutation detected in F1 DNA During 2014
sa6095 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089172 Nonsense 157 449 1 7
ENSDART00000127364 Nonsense 157 449 1 7
Genomic Location:
Chromosome 8 (position 19137431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAAAGACGAGATGTCGACAAGGATGGAGATGCTCATCATGGAGACA[C/T]AGTCGGCTTTCTGCAGAGCCCTGGAGCAGGTGGATGGAGGCTCATTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089172 Essential Splice Site 267 449 3 7
ENSDART00000127364 Essential Splice Site 267 449 3 7
Genomic Location:
Chromosome 8 (position 19135154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACAGTGCACTTCAACTACAGATACTTTGAGATTGARGAAGCAGATGG[T/C]GAGTGCTTTYACAGTCGTGTGAGGAGAGATGTTGTTATCTGCRAGCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cxi323zv