kif1ab

Ensembl ID:
ENSDARG00000062024
ZFIN ID:
ZDB-GENE-070912-480
Description:
Novel protein similar to vertebrate kinesin family member 1 family [Source:UniProtKB/TrEMBL;Acc:B0S7
Human Orthologue:
KIF1A
Human Description:
kinesin family member 1A [Source:HGNC Symbol;Acc:888]
Mouse Orthologues:
Gm1305, Kif1a
Mouse Descriptions:
kinesin family member 1A Gene [Source:MGI Symbol;Acc:MGI:108391]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9755 Nonsense Available for shipment Available now
sa2037 Nonsense F2 line generated During 2016
sa32904 Nonsense Available for shipment Available now
sa12082 Nonsense Available for shipment Available now
sa19735 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089012 Nonsense 18 1770 1 48
ENSDART00000139196 Nonsense 18 1785 2 46
Genomic Location (Zv9):
Chromosome 2 (position 22160183)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23046888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAGGAGCCTCGGTSAAAGTAGCCGTGAGGGTCCGACCCTTYAACTCA[C/T]GAGAGATCGGCAAAGACAGCAAGTGTAWCATCCAGATRTCCGGCAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2037
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089012 Nonsense 645 1770 19 48
ENSDART00000139196 Nonsense 653 1785 18 46
Genomic Location (Zv9):
Chromosome 2 (position 22176871)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23063576
KASP Assay ID:
554-2664.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCTTTGCTCAGAGAGAACTACTGGAGAAACAAGGCATTGACATGAAG[C/T]AAGAGATGGATCAGAGGTAGCWCTTCTGTTCRTGGYACTTTTGTGCTYYT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089012 Nonsense 1083 1770 30 48
ENSDART00000139196 Nonsense 1098 1785 28 46
Genomic Location (Zv9):
Chromosome 2 (position 22191386)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23078091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATCTAGTCTCTCCAGATATTTCTGACAGTCCTCTGAAGGGTGTTCTA[G/T]AATGTCCTCTAGATGTGACTCAAGACAAATCGCTTCAGCACTTAAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089012 Nonsense 1186 1770 32 48
ENSDART00000139196 Nonsense 1201 1785 30 46
Genomic Location (Zv9):
Chromosome 2 (position 22192868)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23079573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAKCAAAAGTCAGCCAATCGTTTTTGAAGTWTTCGGCCACTACCAGAAA[C/T]AACCCTTYCCTCCTCTTTGCAARGACTTAATTAGGTAGGTTTTAGATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089012 Nonsense 1294 1770 36 48
ENSDART00000139196 Nonsense 1309 1785 34 46
Genomic Location (Zv9):
Chromosome 2 (position 22202497)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23089202
KASP Assay ID:
2259-1909.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAATTACAGTCACTATCGCCCATGAAACCGGCAATGATATTGAGTG[G/A]AAAGAAGTTAAAGAACTTGTCATAGGTTAGATTTTCTTCCTCTCTTTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link