fndc3bb

Ensembl ID:
ENSDARG00000062023
ZFIN ID:
ZDB-GENE-070510-2
Human Orthologue:
FNDC3B
Human Description:
fibronectin type III domain containing 3B [Source:HGNC Symbol;Acc:24670]
Mouse Orthologue:
Fndc3b
Mouse Description:
fibronectin type III domain containing 3B Gene [Source:MGI Symbol;Acc:MGI:1919257]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17966 Essential Splice Site Available for shipment Available now
sa25214 Nonsense Mutation detected in F1 DNA During 2014
sa7520 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087991 Essential Splice Site 62 1194 2 25
ENSDART00000147788 None None 1134 None 23
Genomic Location:
Chromosome 24 (position 27651677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACGTTCACCATCCGCATGGAGGACGGGGCTTTGCAGTGCATCCAAGG[T/C]TTGAACAATTCTGTGTTTTGTTTWGTTTWGTTTTTTCCTCTAAGTTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087991 Nonsense 576 1194 14 25
ENSDART00000147788 Nonsense 516 1134 12 23
Genomic Location:
Chromosome 24 (position 27584947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGAGACCCGGACCCCCTGTGAATCCTGCAGTTAACACACTAACATA[T/A]CACAGCTTCTGCGTGACGTGGGGTAGGAAAAACTTTTATCTTTTAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087991 Missense 1022 1194 23 25
ENSDART00000147788 Missense 962 1134 21 23
Genomic Location:
Chromosome 24 (position 27560475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCCACACTTTTAAGTTGCAGAGACTGAATGAATCCAGCAGGTACCGT[T/A]TCCGGATCCAGGCGGTGAGCGWAGCTGGYGAAGGGCCKTTTTCTGAGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/plbq33sm