si:ch211-232d19.4

Ensembl ID:
ENSDARG00000062021
ZFIN ID:
ZDB-GENE-060503-312
Description:
hypothetical protein LOC566663 [Source:RefSeq peptide;Acc:NP_001122012]
Human Orthologue:
C1orf114
Human Description:
chromosome 1 open reading frame 114 [Source:HGNC Symbol;Acc:28051]
Mouse Orthologue:
4930455F23Rik
Mouse Description:
RIKEN cDNA 4930455F23 gene Gene [Source:MGI Symbol;Acc:MGI:1922145]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21254 Nonsense Available for shipment Available now
sa21255 Nonsense Available for shipment Available now
sa9123 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089161 Nonsense 224 497 2 5
Genomic Location (Zv9):
Chromosome 8 (position 19142714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18587602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAAAAGATGGAAAGTTTGATCTGGTGAGTCTTAAGGAAGTAGAAAGT[C/T]AAGGGTTGCTTCCTCCATTGCCAGTTTCTCACAACGACAATCAACGAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089161 Nonsense 243 497 2 5
Genomic Location (Zv9):
Chromosome 8 (position 19142771)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18587659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCCTCCATTGCCAGTTTCTCACAACGACAATCAACGAGCGCCTTTA[C/T]GACAAACTGAGTCTGGTCAGCATCTCAATAAAAGTCCAGTGTCCTCGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089161 Nonsense 458 497 5 5
Genomic Location (Zv9):
Chromosome 8 (position 19147049)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18591937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAGGTGGTTGAGACGGAAGCGCTCAGAGAAAAGAGCRGAACATCAGT[T/A]GGCTMGAGAGCGCTCCCGCAGGCTCATGCTGGAGGAGAGAAGAGCGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link