rufy2

Ensembl ID:
ENSDARG00000062019
ZFIN ID:
ZDB-GENE-070424-66
Description:
RUN and FYVE domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001099151]
Human Orthologue:
RUFY2
Human Description:
RUN and FYVE domain containing 2 [Source:HGNC Symbol;Acc:19761]
Mouse Orthologue:
Rufy2
Mouse Description:
RUN and FYVE domain-containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917682]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6296 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089133 Nonsense 380 698 10 18
ENSDART00000089135 Nonsense 284 602 11 19
ENSDART00000143097 Nonsense 314 632 11 19
Genomic Location (Zv9):
Chromosome 13 (position 23031085)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22760423
KASP Assay ID:
554-5070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTCAGGYTACAGAAGGAGATTTGARCTGTGAGTTGGACACGTACAAG[C/T]AGTCAAGGCAGGGCCTGGATGAAATGTACAACGAGGCKAGACGCCAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link