fsd1

Ensembl ID:
ENSDARG00000062017
ZFIN ID:
ZDB-GENE-060503-218
Description:
Fibronectin type III and SPRY domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LY10]
Human Orthologue:
FSD1
Human Description:
fibronectin type III and SPRY domain containing 1 [Source:HGNC Symbol;Acc:13745]
Mouse Orthologue:
Fsd1
Mouse Description:
fibronectin type 3 and SPRY domain-containing protein Gene [Source:MGI Symbol;Acc:MGI:1934858]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15589 Nonsense Available for shipment Available now
sa7611 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089141 Nonsense 42 494 3 14
Genomic Location:
Chromosome 8 (position 19152733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGACATGCTGCTTGAACTCTTGGTCACGGTGTGTGCAGGCGAATTCAAAC[C/T]GAGTGCAGGAAGACCWGGAGTCAGAGTTTAGTTCGCTGCATTCGGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089141 Missense 211 494 8 14
Genomic Location:
Chromosome 8 (position 19159410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGACCACTACATCCTGGAGCATCGRAAAACCAATCAYGAGGGTCCACCG[C/T]GGGYTCGTGAGGACTATCCCTGGATGGTGGTGGAGGGAATTAAAGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5ns1o6h6