c11orf2

Ensembl ID:
ENSDARG00000062016
ZFIN ID:
ZDB-GENE-030131-6008
Description:
Protein fat-free [Source:UniProtKB/Swiss-Prot;Acc:Q155U0]
Human Orthologue:
C11orf2
Human Description:
chromosome 11 open reading frame 2 [Source:HGNC Symbol;Acc:1172]
Mouse Orthologue:
1110014N23Rik
Mouse Description:
RIKEN cDNA 1110014N23 gene Gene [Source:MGI Symbol;Acc:MGI:1915755]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11553 Nonsense Available for shipment Available now
sa14534 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089144 Nonsense 44 827 1 11
Genomic Location:
Chromosome 10 (position 27597589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATGAGGAAGGAAAAGCCACAGAACAAGCCGAGTCTCTGGATCCTTG[C/A]GATATCAACGGACCGCATTTCGACCCAGAGATTTATTTAAATAAGGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089144 Nonsense 313 827 5 11
Genomic Location:
Chromosome 10 (position 27601243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTATCCCCTAGTTCCTCTGTGTCCAATCCCTTCCTTTCCCCTGCCGCC[G/T]GAACAGACATATTGGAGTTCATAGATMGAGGGTGTAACGAGTTTGTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/npoquxkm