si:ch211-198g19.1

Ensembl ID:
ENSDARG00000062013
ZFIN ID:
ZDB-GENE-070705-89
Description:
Novel protein similar to vertebrate thyrotropin-releasing hormone degrading ectoenzyme (TRHDE) [Sour
Human Orthologue:
TRHDE
Human Description:
thyrotropin-releasing hormone degrading enzyme [Source:HGNC Symbol;Acc:30748]
Mouse Orthologue:
Trhde
Mouse Description:
TRH-degrading enzyme Gene [Source:MGI Symbol;Acc:MGI:2384311]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20281 Nonsense Available for shipment Available now
sa40299 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20280 Nonsense Available for shipment Available now
sa33467 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089126 Nonsense 181 994 1 19
ENSDART00000133184 Nonsense 181 894 1 16
Genomic Location (Zv9):
Chromosome 4 (position 22578420)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23921755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGACAGTAAAAAAGCGGGCGCCATGCGGATCCAGCGCCGCTTCCACTA[T/G]CAGCCCAAACAGGTGTATGTGATCGCGCTGCACAGAGAGATGAAGCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089126 Essential Splice Site 636 994 11 19
ENSDART00000133184 Essential Splice Site 658 894 11 16
Genomic Location (Zv9):
Chromosome 4 (position 22422386)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23765721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTAGCTACTGCACAGTGATTTTCTTTTCATGCTCATGTATTTAC[A/T]GAGGCGCACAGAGTGGGTCACGTGGTTGGTGAGACGTGGTTGCTGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089126 Nonsense 648 994 11 19
ENSDART00000133184 Nonsense 670 894 11 16
Genomic Location (Zv9):
Chromosome 4 (position 22422347)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23765682
KASP Assay ID:
2259-4952.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTATTTACAGAGGCGCACAGAGTGGGTCACGTGGTTGGTGAGACGTG[G/A]TTGCTGGGCAACATCAACCAGACGGGCTACTTTAGAGTGAACTACGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089126 Essential Splice Site 748 994 13 19
ENSDART00000133184 Essential Splice Site 770 894 13 16
Genomic Location (Zv9):
Chromosome 4 (position 22401127)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23744462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGTTGGACAAACTCCTGGACCGCACTTTAGACCACAGCCTGTTCAGC[G/A]TGAGTCTGAACTTACATCAGTTTAATGAATGTTGTGTTTTAGCCTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089126 Nonsense 911 994 17 19
ENSDART00000133184   None 894 None 16
Genomic Location (Zv9):
Chromosome 4 (position 22382996)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23726331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATGTGGCCCGCAATCCACTGGGAAGACATTTAGCATGGAGATATTTC[A/T]GAGAGAAGTGGGACATATTGAACTCCAGGTGAATGTAGTTCTATTCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link