NP_001155104.1

Ensembl ID:
ENSDARG00000062003
Description:
myosin-Vb [Source:RefSeq peptide;Acc:NP_001155104]
Human Orthologue:
MYO5B
Human Description:
myosin VB [Source:HGNC Symbol;Acc:7603]
Mouse Orthologue:
Myo5b
Mouse Description:
myosin VB Gene [Source:MGI Symbol;Acc:MGI:106598]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43638 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089030 Nonsense 1590 1839 37 41
Genomic Location (Zv9):
Chromosome 21 (position 21406558)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22417980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGGCGGAGTACCGACAGGTTCTGAGTGACCTCTCCATCCAAATCTA[T/A]CAGCAGCTTGTGAAAGTTGCCGAGGCCAACATGCAGCCCATGATCGGTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link