acacb

Ensembl ID:
ENSDARG00000061994
ZFIN ID:
ZDB-GENE-060526-132
Description:
Novel protein similar to vertebrate acetyl-Coenzyme A carboxylase beta (ACACB) [Source:UniProtKB/TrE
Human Orthologue:
ACACB
Human Description:
acetyl-CoA carboxylase beta [Source:HGNC Symbol;Acc:85]
Mouse Orthologue:
Acacb
Mouse Description:
acetyl-Coenzyme A carboxylase beta Gene [Source:MGI Symbol;Acc:MGI:2140940]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1230 Nonsense Available for shipment Available now
sa1338 Nonsense Available for shipment Available now
sa40385 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089078 Nonsense 564 2251 13 52
ENSDART00000148130 Nonsense 564 2243 13 51
Genomic Location (Zv9):
Chromosome 5 (position 21132563)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18845435
KASP Assay ID:
554-1139.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAGGCAGAGAGGCCAGATACTATGTTAGGTGTGGTATGCGGAGCTCTA[C/T]AAGTGGCTGATGCAAGTTTTAGAGAAAGCATGTCTGACTTCCTGCATTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089078 Nonsense 1489 2251 36 52
ENSDART00000148130 Nonsense 1481 2243 35 51
Genomic Location (Zv9):
Chromosome 5 (position 21152708)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18865580
KASP Assay ID:
554-1252.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGAGACAAACAAGGCCCGCTGAACGGCATGCTCATAAACACACCATA[C/A]GTCACWAAGGATTTACTCCAGGCCAAGCGCTTCCAGGCTCAGAGCCTCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089078 Essential Splice Site 1808 2251 42 52
ENSDART00000148130 Essential Splice Site 1800 2243 41 51
Genomic Location (Zv9):
Chromosome 5 (position 21158219)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18871091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGAAGGAGTGCTCACTATTCTACAGTGGTTATCCTACATGCCAAAG[G/A]TAGTTTCTAATTACTTATAGGTAGGGCCAGAAGGAATCTGCGGATGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link