acacb

Ensembl ID:
ENSDARG00000061994
ZFIN ID:
ZDB-GENE-060526-132
Description:
Novel protein similar to vertebrate acetyl-Coenzyme A carboxylase beta (ACACB) [Source:UniProtKB/TrE
Human Orthologue:
ACACB
Human Description:
acetyl-CoA carboxylase beta [Source:HGNC Symbol;Acc:85]
Mouse Orthologue:
Acacb
Mouse Description:
acetyl-Coenzyme A carboxylase beta Gene [Source:MGI Symbol;Acc:MGI:2140940]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1230 Nonsense Available for shipment Available now
sa1338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089078 Nonsense 564 2251 13 52
ENSDART00000148130 Nonsense 564 2243 13 51
Genomic Location:
Chromosome 5 (position 21132563)
KASP Assay ID:
554-1139.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAGGCAGAGAGGCCAGATACTATGTTAGGTGTGGTATGCGGAGCTCTA[C/T]AAGTGGCTGATGCAAGTTTTAGAGAAAGCATGTCTGACTTCCTGCATTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089078 Nonsense 1489 2251 36 52
ENSDART00000148130 Nonsense 1481 2243 35 51
Genomic Location:
Chromosome 5 (position 21152708)
KASP Assay ID:
554-1252.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGGAGACAAACAAGGCCCGCTGAACGGCATGCTCATAAACACACCATA[C/A]GTCACWAAGGATTTACTCCAGGCCAAGCGCTTCCAGGCTCAGAGCCTCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/su43q5k5