dot1l

Ensembl ID:
ENSDARG00000061992
ZFIN ID:
ZDB-GENE-060503-341
Description:
Novel protein similar to vertebrate DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L)
Human Orthologue:
DOT1L
Human Description:
DOT1-like, histone H3 methyltransferase (S. cerevisiae) [Source:HGNC Symbol;Acc:24948]
Mouse Orthologue:
Dot1l
Mouse Description:
DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143886]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37502 Essential Splice Site Available for shipment Available now
sa1413 Nonsense Available for shipment Available now
sa39369 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17639 Nonsense Available for shipment Available now
sa43826 Nonsense Mutation detected in F1 DNA During 2017
sa17278 Essential Splice Site Available for shipment Available now
sa44985 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43825 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 42 1523 2 28
ENSDART00000142046 Essential Splice Site 51 1122 2 27
Genomic Location (Zv9):
Chromosome 22 (position 21136744)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20791420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGATAAACATCATGATGCTGCACACGAAATCATCGAAACCATTCGG[T/C]GAGTCCATTACCTGTTTTGATTTGATATTATTATTATTATTATTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 180 1523 6 28
ENSDART00000142046 Nonsense 189 1122 6 27
Genomic Location (Zv9):
Chromosome 22 (position 21133124)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20787800
KASP Assay ID:
554-1334.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGGGGTCGGTCAGGTGGTCCTGCAAGTTGCTGCGGCCACCAATTGT[A/T]AACACTACTATGGCGTGGAGAAAGCAGACATTCCAGCTACCTATGCAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 263 1523 9 28
ENSDART00000142046 Essential Splice Site 272 1122 9 27
Genomic Location (Zv9):
Chromosome 22 (position 21132592)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20787268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGGTGGACCACCAGTTGAAGGAACGATTCGCCAACATGAAGGAAGG[T/C]TCGTGGAGTTGAATTTGATATTACAGTATGGATGCACACTAGTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 338 1523 13 28
ENSDART00000142046 Nonsense 347 1122 13 27
Genomic Location (Zv9):
Chromosome 22 (position 21129133)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20783809
KASP Assay ID:
2261-6783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAWTTCTCTTCCCACAACAYATGCGGTGTGTTTTTGGTTCCAGGAGGAA[C/T]AGGAGGTTGCCAGAAGGCGCCCACAGAAGGACAGTAAAGAGAACAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 636 1523 20 28
ENSDART00000142046 Nonsense 644 1122 20 27
Genomic Location (Zv9):
Chromosome 22 (position 21118042)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20772718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTGAATCATTGGCTCCCCCTGCTGTTTGTTTCCAGATCAGTATAGTT[G/T]AACTCGAGAAGAGCCAGCGACAGCAGGAGCTCCTTCAGCTCAAGTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 782 1523 20 28
ENSDART00000142046 Essential Splice Site 790 1122 20 27
Genomic Location (Zv9):
Chromosome 22 (position 21117601)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20772277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGATTCAGCCGCAAACCAGTTYCGGGCACTCGGAAACAWCCATCGG[T/G]GAGTGAAAGTTAGCCAATTAGTTSAGTAAGTACTTATCTATTGGTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Essential Splice Site 889 1523 23 28
ENSDART00000142046   None 1122 None 27
Genomic Location (Zv9):
Chromosome 22 (position 21114666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCCAGCAGGACAGAGCAATGGCAAGCCACCTCTCACGCCTACCTCAG[G/A]TACAGGTCTGCCTTGTTTTTTTTATTTTATTTTTTTTATGCGAAGCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089076 Nonsense 1278 1523 27 28
ENSDART00000142046   None 1122 None 27
Genomic Location (Zv9):
Chromosome 22 (position 21109126)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20763802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGTAAACACGTCAGAGCGTTCGCTGCAGAAACAGAAAGTGCGGGAGT[G/A]GGACCTGAAATCTGTAAGTGGATTGGCCAGTCAAAACCTATTTATATCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Osteoarthritis: Genome-wide association and functional studies identify the DOT1L gene to be involved in cartilage thickness and hip osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link